TumblrPics.com
HOME
DMCA
Live
Gallery
Viewer
Fat Gainer
mistress word
auuguauguauguaguauauuaguoiaiai
Imagine sucking
Girl pretend suck
jesssicawalker
LIVE
Just a little something to get started
I think the weight difference here is about 25 pounds (192 to 217)
hornyssbbwwhales:Wanna fuck a horny fatty? - CLICK HERE!
The feigned look of shock on his face is so that his friends don’t think he’s actually enjoying the
Video of me drinking gainer shake available on my patreon https://www.patreon.com/posts/gainer-shake
couchqueenie:My waistline is disappearing faster than my excuses not to go to the gym.No way you’d c
Nutty’s 70 pound gain!
messy-cuties:4 BIG chocolate cakes devoured by Julie piggy-style! See her get super messy!
Nutty gets stuffed until she’s completely full!
force-feed-her:Julie takes an epic messy force feeding! See it up close and personal!
brendakthedonutgirl:This progress makes me feel so happy!It makes ME very happy that it makes you ha
Every year, Carmen outgrows her New Year’s dress a little bit more!
Wanna fuck a horny bbw chick? - CLICK HERE!
fathungryssbbwwhales:Wanna fuck a horny bbw? - CLICK HERE!
Wanna fuck a horny bbw chick? - CLICK HERE!
gainingssbbwwhales:Wanna fuck a hot horny fat chick? - CLICK HERE!
Wanna fuck a horny bbw chick? - CLICK HERE!
Bursting
Despite what you might think, I do still work out
Wanna fuck a horny bbw chick? - CLICK HERE!
Just weighed in at 235 , feeling great
Kitty and Aliss both love pasta. But who loves pasta more? Find out!
fathungryssbbwwhales:Wanna fuck a horny bbw? - CLICK HERE!
Another commission for Jobode and part three of their sequence! The girls are getting pretty chunky.
Prev Page
Next Page