TumblrPics.com
HOME
DMCA
Live
Gallery
Viewer
English Prince
alphas only
the-courteous-kitten
ask-master-who
mistress word
auuguauguauguaguauauuaguoiaiai
LIVE
The Twin Princesses, from The Lily of Life by Helen Stratton (1913)
The Real Game of Thrones — Wars of the Roses Part III, The Princes of the TowerFor previous in
princessnijireiki:Afro-British actors Antonia Thomas (Jamaican & English) and Regé-Jean Page (Zi
Prince Albert Victor died at Sandringham on this day in 1892. His engagement to Princess May of Teck
Charles Folkard (1878-1963), “The Princess and the Goblin” by George MacDonald, 1949Sour
Tomb of Edward Plantagenet, The Black Prince (15 June 1330 – 8 June 1376), Canterbury Cathedral.
diana-prince:That sequence occurs in the grim no-man’s-land between English and German battlefield t
scotianostra:October 18th 1541 saw the death of Margaret Tudor, English princess, sister of Henry VI
On this day in history, 8th of June 1376, Edward of Woodstock, Prince of Wales died at Westminster P
Robert Pattinson Does Not Want To Play An English Prince, Thank You Very MuchBritish actor Robert Pa
King Edward III of England (1312-1377) grants Aquitaine to his son, Edward the Black Prince. Initia
Portrait of Caroline of Brunswick (Caroline, Princess of Wales), Thomas Lawrence, 1798
John D. Batten (1860-1932), ‘Danhasch carries off Badoura’, from “Fairy Tales fro
SHE’S BACK!
oldpaintings:Hamlet, Prince of Denmark (pub.1922) by John Austen (English, 1886–1948)
cuirassier:14th century English Princess and Lady-in-Waiting, from “Medieval fashions” by Tom Tierne
Princess Charlotte Augusta of Wales (1817). George Dawe (English, 1781-1829). Oil on canvas. Nationa
pintoras:Emma Sandys (English, 1834 - 1877): A Saxon princess (via Sotheby’s)
English Tranter revolver, engraved by R. S. Garrard & Co. for The Prince of Wales (future King E
Favourites, the Property of H.R.H. Prince George of Cambridge, Sir Edwin Henry Landseer, 1834-35
Mary Tudor (1496 - 1533) and Charles Brandon (1484 - 1545), depicted here in their marriage portrait
princedavekat:mulattafury:People are always getting my races for the kids wrong? I don’t know if it’
Prev Page
Next Page